shc002
Buy SHARANWARE shc002 Hose Pipe online at
shc002
website shc002 The antibiotic resistance for bacterial transformations in SHC002 includes an ampicillin resistance cassette However, it is recommended to use the more stable shc002 SHC002 MISSION Non-Mammalian shRNA Control, TRC1, Non human or mouse shRNA, CCGGCAACAAGATGAAGAGCACCAACTC-GAGTTGGTGCTCTTCATCTTGTTGTTTTT SHC003
shc002 Levels of SHC002 and SHC016 cassettes were similar at 2 days after transduc- tion in both cell lines However, in contrast to the empty vector and pLKO-SHC002 SHC002 MISSION Non-Mammalian shRNA Control, TRC1, Non human or mouse shRNA, CCGGCAACAAGATGAAGAGCACCAACTC-GAGTTGGTGCTCTTCATCTTGTTGTTTTT SHC003 SHC002 MISSION Non-Mammalian shRNA Control, TRC1, Non human or mouse shRNA, CCGGCAACAAGATGAAGAGCACCAACTC-GAGTTGGTGCTCTTCATCTTGTTGTTTTT SHC003
Unable to load receipt Availability
